quick search all data all static web pages gene products gene models genomes loci locus lookup maps people/organizations phenotypes/mutants probes/markers  - BACs  - clones  - ESTs  - overgos  - SSRs projects QTL experiments references stocks traits variations/alleles i.d. number

Maize Gametophyte Project - validated Ds-GFP insertions

64 of 83 putative transposable element insertions obtained from the Dooner/Du Ds-GFP (also called dsg or tdsg) collection at the Maize Genetics Cooperation Stock Center (acdsinsertions.org) were verified to have Ds-GFP insertions at the predicted sites by PCR (Table A). Because these insertions were selected to be located in coding sequence, they represent putative knockout alleles for the mutated gene. The predicted insertion site was not found in 19 of 83 Ds-GFP elements, using primers designed to amplify a Ds insertion at that location (Table B). However, extensive PCR optimization was not pursued with this material, so although these insertions are currently designated as 'non-verified', we do not conclude that the acdsinsertions.org prediction is incorrect.

All lines were also tested for the presence of only a single Ds-GFP insertion by outcrossing and identifying co-segregating single elements in progeny kernels based on the fluorescent GFP endosperm phenotype (Fig. 1) and a diagnostic PCR band. As originally acquired from the Stock Center, a few lines appeared to harbor more than a single Ds-GFP element, based on outcross segregation patterns. From these lines, only progeny segregating for a single insertion were tested further. Several lines also harbored the wx1-m7::Ac element (by PCR), which was used in the initial mobilization of the Ds-GFP element (Li et al. 2013).

Based on the GFP endosperm phenotype, all 83 single insertions segregate 1:1 when the insertion line is used as the female in an outcross; however, 9 of the 64 verified and 1 of the 19 non-verified insertion lines are associated with a male-specific transmission defect. These are likely due to a causal mutation from the Ds-GFP insertion. Transmission rates through the male, as well as primer sequences used for PCR genotyping, are available in the tables below, reproducing select data from Warman et al. (PLoS Genetics 2020) and Warman et al. (bioRxiv 2020).

Contact: John Fowler

References:
High expression in maize pollen correlates with genetic contributions to pollen fitness as well as with coordinated transcription from neighboring transposable elements. Warman C, Panda K, Vejlupkova Z, Hokin S, Unger-Wallace E, Cole RA, Chettoor AM, Jiang D, Vollbrecht E, Evans MMS, Slotkin RK, Fowler JE. PLoS Genet. 2020 Apr 1;16(4):e1008462. https://doi.org/10.1371/journal.pgen.1008462
MaizeGDB reference

A cost-effective maize ear phenotyping platform enables rapid categorization and quantification of kernels. Warman C, Sullivan CM, Preece J, Buchanan ME, Vejlupkova Z, Jaiswal P, Fowler JE. bioRxiv 2020 https://www.biorxiv.org/content/10.1101/2020.07.12.199000v1

Gene tagging with engineered Ds elements in maize. Li, Y., G. Segal, Q. Wang, and H. K. Dooner. 2013 Methods in Molecular Biology: Plant Transposable Elements, 1057: 83-99. T. Peterson, ed. Springer Science & Business Media, NY. https://doi.org/10.1007/978-1-62703-568-2_6
Download pdf file

Table A. Validated Ds-GFP insertions.

Table B. Unverified Ds-GFP insertions.

Validation of Ds-GFP insertion sites – Methods (from Warman et al, 2020)

A FASTA file containing 2 kb of genomic sequence surrounding each Ds-GFP insertion site was used as input to a primer3-based tool to generate a pair of specific primers to genotype individual plants from each line (https://vollbrechtlab.gdcb.iastate.edu/tools/primer-server/). The primers used for each Ds-GFP line are listed in S6 Table from Warman et al, and are shown below.

To genotype the plants, two 7 mm discs of leaf tissue were collected from each plant using a modified paper punch. The samples were collected in 1.2 ml tubes that fit within a labeled 96 well plate/rack (https://vollbrechtlab.gdcb.iastate.edu/tools/tissue-sample-plate-mapper/) (Phenix Research Products, Candler, NC; M845 and M845BR or equivalent). Genomic DNA was isolated from the leaf punches with the following modifications. An additional centrifugation (3,000 g for 10 min.) was added to clear the leaf extracts prior to loading onto a 96-well glass fiber filter plate (Pall, 8032). DNA was eluted from filter plates in 125 μL water, and 2 μL was used as template for PCR. Amplification followed standard PCR conditions using GoTaq Green Master Mix (Promega) with 4% DMSO (v/v) and amplicons were resolved using agarose gel electrophoresis. Lines were genotyped using the pair of gene-specific primers, designed to amplify flanking sequence at the predicted insertion site, plus one Ds-specific primer (JSR01 GTTCGAAATCGATCGGGATA or JGP3 ACCCGACCGGATCGTATCGG). All lines were also screened by PCR for the presence of wx1-m7::Ac using primers for wx1 (CACAGCACGTTGCGGATTTC) and Ac (CCGGATCGTATCGGTTTTCG). Followup PCR to test for co-segregation of GFP fluorescence with the presence of the insertion used the appropriate set of three PCR primers (two gene-specific and one Ds-specific) and DNA prepared either from endosperm or seedling leaves.

Heterozygous lines with PCR-validated Ds-GFP insertion alleles were planted in the Botany & Plant Pathology Field Lab (Oregon State University, Corvallis, OR). All insertions were in coding sequence (CDS) sites. Heterozygous Ds-GFP plants were outcrossed to tester plants (c1 wx1/c1 wx1 or c1/c1 genetic background) through both the female and the male, with male pollinations made with a heavy pollen load on extended silks (silks that had been allowed to grow for at least two days following cutback). Following harvest, resulting ears were imaged using a custom rotational scanner in the presence of a blue light source and orange filter for GFP seed illumination. Briefly, videos were captured of rotating ears, which were then processed to generate flat cylindrical projections covering the surface of the ear. Seeds were manually counted using the Cell Counter plugin of the Fiji distribution of ImageJ.

This work was funded by National Science Foundation grants IOS-1340050 and MCB-1832186